Question: Select the correct statement(s) about genome size and density.

Answer: Eukaryotic genomes are larger than prokaryotic genomes.

Question: Why is the outdated term "junk DNA" a misnomer for noncoding regions of the human genome?

Answer: The conservation of "junk DNA" sequences in diverse genomes suggests that they have important functions.

Question: How do transposons differ from retrotransposons?

Answer: Transposons may or may not leave a copy behind at the original site, whereas retrotransposons always leave a copy behind at the original site.Transposons move by means of a DNA intermediate, whereas retrotransposons move by means of an RNA intermediate.

Question: Which of the findings of the Human Genome Project were contrary to initial expectations?

Answer: The human genome contains fewer than 21,000 genes.Ninety-three percent of multi-exon human genes have alternatively spliced forms.

Question: Identify the correct statement(s) about transposable elements.

Answer: Transposable elements and related sequences make up 44% of the human genome.

Question: What are the steps in the shotgun approach to whole-genome sequencing?Drag the labels to their appropriate locations on the flowchart. Only some labels will be used.

Answer: Multiple copies of the same chromosome are preparedChromosome copies are broken into 1-kb fragments1-kb fragments are cloned into plasmidsThe plamsids are sequencedA computer combines the fragment sequences

Question: Enter the complete DNA sequence, which should contain 24 bases.

Answer: GATGACATGGCGTCAGTCGATGCG

Question: What was the main goal of the Human Genome Project (HGP)?

Answer: to map all the human genes and determine the nucleotide sequence of the entire human genome

Question: Which of the following statements about genome sizes is true?

Answer: Most eukaryotes have larger genomes than most prokaryotes.

Question: The number of genes correlates with __________.

Answer: the size of the genome in prokaryotes

Question: What type of noncoding DNA composes the largest portion of multicellular eukaryotic genomes?

Answer: transposons

Question: How do retrotransposons differ from other transposons?

Answer: Retrotransposons move via an RNA transcript, whereas other transposons do not.

Question: How has gene duplication played a critical role in evolution?

Answer: It produces redundant copies of existing genes, which are then free to mutate and adopt new functions.

Question: By what mechanism might transposons contribute to gene duplication?

Answer: Transposons may promote unequal crossing over during meiosis

Question: What is the percent identity between the β and ε globin sequences?

Answer: 0.76

Question: What percent identity is implied by the dashes?

Answer: 100% identity

Question: Notice that the cells in the lower left half of the table are blank. Why?

Answer: They represent duplicates of the comparisons in the upper right half of the table.

Question: Based on that premise, identify which two globin genes are the most recently duplicated. What is the percent amino acid identity between them?

Answer: α1 and α2 , with 100% amino acid identity

Question: Which two globin genes are most divergent from each other? What is the percent amino acid identity between them?

Answer: β and ζ, with 38% amino acid identity

Question: Does the order of pairs in the table above describe the same relative "closeness" of globin family members as shown in the model?

Answer: Yes. Pairs of globins at the top of the table are drawn with the closest connections in the model.

Question: Which of the following percent identities is a good cut-off value separating within-family pairings from between-family pairings?

Answer: 0.5

Question: What is the goal of comparative genomic studies?

Answer: All of the listed responses are goals of comparative genomic studies

Question: What are Hox genes?

Answer: Hox genes encode transcription factors with a DNA-binding domain called a homeo box and regulate development of the vertebrate body plan.

Question: In which section of the search results can you find nucleotide-by-nucleotide comparisons between your query sequence and similar database sequences?

Answer: Alignments

Question: How do the E values change as you go from the top of the list of hits to the bottom?

Answer: The E values get larger.

Question: Which statement best describes the results shown in the Descriptions section?

Answer: A hit derived from Fusarium redolens is the best match to the query sequence.

Question: Which kingdom does Fusarium redolens belong to?

Answer: Fungi

Question: Other than the genus and species information, what characteristics do most of the top hit sequences share? Select the two best answers.

Answer: They contain a ribosomal RNA (rRNA) sequence.They contain a sequence of an internal transcribed spacer (ITS).

Question: In how many positions are there nucleotide differences between your query sequence and the sequence of accession AY259214.1?

Answer: 10

Question: How does the alignment of the FN397219.1 sequence to your query sequence compare to the alignment of the AY259214.1 sequence you examined in Part F?

Answer: In the FN397219.1 alignment, there are the same number of nucleotide differences but more gaps.

Question: Did you find any sequences in the human genome that were statistically similar to your query sequence?

Answer: Similar sequences were found only with the blastn (lower similarity) search.

Question: Based on the information given in the three different sections, which of the following statement(s) correctly describe(s) the hit that is most similar to the query sequence? Select all that apply.

Answer: ts accession number is CAM33009.1.It is identical to the query sequence in length and amino acid sequence.It is a chimeric protein.

Question: Identify the three main categories of hits in terms of similarity to the query sequence. (For help approaching this question, see Hint 1.)

Answer: sequences that are similar to the entire length of the query sequencesequences that are similar to the first 75 amino acids of the query sequencesequences that are similar to the last 170 amino acids of the query sequence

Question: Examine the descriptions for the group of hits that align with the N-terminal end of the query sequence. Which of the following terms are found among these descriptions? Select all that apply.

Answer: BCR variant proteinbreakpoint cluster region proteinunnamed protein product

Question: On which chromosome is the BCR gene normally located?

Answer: 22

Question: Which type of chromosomal rearrangement accounts for the creation of the gene that encodes the BCR-ABL chimeric protein? (For a review of the four different types of chromosomal rearrangements, see Hint 1.)

Answer: translocation

Question: Which segment of the normal ABL protein aligns with the query sequence? Provide your answer in this format: number of first amino acid, number of last amino acid. (For example, if the first amino acid is 23 and the last amino acid is 413, enter 23, 413.)

Answer: 80246

Question: DNA fragment A consists of _____ base pairs.

Answer: 1268

Question: Which of these genes are located on the q arm of chromosome 17?

Answer: gastrin and GH1

Question: The RP13 gene of chromosome 17 codes for a protein _____.

Answer: involved in eye development

Question: The gene that codes for gastrin is located on the _____ of chromosome 17.

Answer: q arm

Question: The TP53 gene of chromosome 17 codes for a protein _____.

Answer: involved in the regulation of the cell cycle

Question: Which of these genes codes for a protein that plays a role in growth?

Answer: GH1

Question: Which of these genes codes for a protein that plays a role in white blood cell function?

Answer: MPO

Question: Bioinformatics includes all of the following EXCEPT __________.

Answer: using DNA technology to combine DNA from two different sources in a test tube

Question: Homeotic genes __________.

Answer: encode transcription factors that control the expression of genes responsible for specific anatomical structures

Question: Two eukaryotic proteins have one domain in common but are otherwise very different. Which of the following processes is most likely to have contributed to this similarity?

Answer: exon shuffling